Ensembl 116 + Ensembl Genomes 63 are out! Explore new pig, cattle, and oat genomes, updated alignments and new VEP plugins
It’s a milestone! Our last on the current platform. New data from here on is via beta.ensembl.org
More info on our blog: zurl.co/MrJ2A
1/ My favourite gene has 15 transcripts, which one should I use for further analysis? To report the position of variants? To design primers for? 🤯
This #tweetorial will show you how to filter and prioritise transcripts… 🧵
#genomics#bioinformatics#Ensembltraining 🧬
ALT Screenshot of the transcript table of the LAMA3 gene in the Ensembl genome browser
1/ Want to learn about a gene, but there’s no functional data for that species? Or maybe you're looking for a homologue of your favourite gene in a model organism?
Here's how you can find orthologues in @ensembl. A thread…🧵
#genomics#bioinformatics#Ensembltraining🧬
ALT Screenshot of the Ensembl genome browser showing 4 transcripts of the KPNA2 gene, with exons and introns represented as lines and boxes. There is an additional genomic feature, a promoter, represented as a red box.
Want to learn about a gene function, but there’s no functional data in your species of interest? Or maybe looking for a homologue of your fav gene in a model organism to carry out functional work? Look no further! This #tweetorial will show you how to find orthologues in @ensembl
1/ Do you want to know if a variant will affect the structure and function of a protein?
We’ve got lots of tools and #data in @ensembl to help you investigate and we’re here to show you how! A thread...🧵
#genomics#bioinformatics # #tweetorial#Ensembltraining🧬
ALT Screenshot of protein structure viewer in Ensembl showing alpha-helical structure with highlighted amino acid residue at variant position
1/ There are so many bioinformatics databases 🤯 How do we find the corresponding genes and other related #data?
This #tweetorial will show you how to find the links from Ensembl to those other databases… 🧵
#genomics#bioinformatics#Ensembltraining 🧬
ALT Screenshot of the summary information on the BRCA2 gene page from the Ensembl genome browser
Ensembl is 20 years old 🎂! We're celebrating our #birthday by trawling through the archives to bring you a blast from the past- here is @ewanbirney's announcement e-mail from 2000!
(Even the @emblebi logo has changed quite a lot)
agcaccgcgtatagcgcgtttgaaacccatattagcccggcgaacgatgaaatgatttgctgccatcgcattagcaccatggcgagc
buff.ly/2HHmHXH
We hope you all have a safe and enjoyable Christmas
1/ From ~20,000 coding genes in humans, biological complexity is also the result of gene/transcript expression levels in different tissues 📈
Want to see the expression of a #gene using @ensembl? A thread...🧵
#genomics#bioinformatics#tweetorial#Ensembltraining 🧬
ALT Screenshot from the Ensembl genome browser showing the location tab with tracks displaying gene models and RNASeq alignments from adipose and blood tissue
The genome sequence of a man has been published - despite having no genetic material. Hans Jonatan, born 236 years ago, had his genome reconstructed using information from 182 of his descendants @ScienceNordicbuff.ly/2obcXds
Ensembl is 23 years old 🎂! Check out
@ewanbirney's e-mail from 2000 announcing Ensembl and different ways to access our data. We have added lots more routes to access our data now (buff.ly/3wvSUZU).
1/ Are you designing #CRISPR experiments in human cell lines or in mouse?🧑🤝🧑🐭
Just a few clicks in @ensembl can help you design your gRNA sequence and this #tweetorial will show you how… 🧵
#genomics#bioinformatics 🧬
1/ Do you want to know if a variant will affect the structure and function of a protein?
We’ve got lots of tools and #data in @ensembl to help you investigate and we’re here to show you how! A thread...🧵
#genomics#bioinformatics#tweetorial#Ensembltraining🧬
Ensembl 99 and @ensemblgenomes 46 have now been released!
🔸 38 new vertebrate species, 2 dog breeds and 4 updated #genomes including #data from @genomeark
🔸 New #plant species 🌾🌱🌿
🔸 Updated human variation data 👫
Read more in our latest blog post:
buff.ly/35ZTf7s
Ensembl version 94 has been released! Check out our blog post to explore what exciting new data you can find now in Ensembl, including updates to 👫, 🐁 and loads more 🐟🐠🐡! #Ensembl94
Perhaps you can try #FindingNemo...?
buff.ly/2RmV8Fd
Happy #NationalDNADay 🧬
It's been 18 years since the completion of the #HumanGenomeProject and 68 years since James Watson, Francis Crick, Maurice Wilkins, Rosalind Franklin and colleagues published papers on the structure of #DNA in @nature.
1/ Did you know that #Ensembl houses annotation for over 35,000 genomes (a number which is only going to continue growing!) organised across different websites?
This thread is here to help you find the species you are looking for...🧵
#genomics#bioinformatics#tweetorial 🧬
ALT Radial species tree representing the species available in the Ensembl genome browser
Happy International DNA Day 🎉 🎊
We're commemorating the completion of the Human #Genome Project in 2003 and the discovery of DNA's double #helix in 1953.
Have a look at our #DNA guide!
#DNADay
1/ Knowing the frequency for alleles of genomic variants in populations around the world helps us understand phenotypes and disease 🌎🌍🌏
We’re here to take you through the data in @ensembl step-by-step. A thread…🧵
#genomics#bioinformatics#tweetorial#Ensembltraining🧬
1/ Are you working with human variation data? 🧑🤝🧑Are you interested in phenotypes and disease?
Here's how you can find the clinical significance of variants using #Ensembl. A thread...🧵
#genomics#bioinformatics#tweetorial#Ensembltraining 🧬
ALT Screenshot Ensembl genome browser showing the variant summary for genomic variant 'rs334'
1/ From ~20,000 coding genes in humans, biological complexity is also the result of gene/transcript expression levels in different tissues 📈
Want to see the expression of a #gene using @ensembl? A thread...🧵
#genomics#bioinformatics#tweetorial#Ensembltraining 🧬
ALT Screenshot from the Ensembl genome browser showing the genomic location of the SERPINA3 gene, with tracks turned on showing RNAseq BAM alignments and RNAseq gene models for adipose tissue and blood
📢 @GoogleDeepMind’s new AI tool, #AlphaMissense, has catalogued 89% of all 71 million possible missense #variants, predicting their potential to cause disease 🧬 Best part? It is freely available and now integrated as an #Ensembl#VEP plugin! 🥳
➡️ buff.ly/3WSLpbA
Uncovering the causes of disease is one of the greatest challenges in genetics. 🧬
To help advance this, we created AlphaMissense: an AI model classifying missense variants - or genetic changes affecting proteins.
Here's how it can help scientists. 🧵 dpmd.ai/alphamissense-blog
#Codons matter! New in vivo study in 🐁 finds that codons ending in a G or C have higher #protein lifetimes & abundance, mRNA abundance, & translation rates than those ending in A/U! A hidden impact of #synonymous variants?
#CitedEnsembl@eufornabuff.ly/2PHLj7E
📢 We are thrilled to announce that Ensembl 110 / Ensembl Genomes 57 is out! The new #release features updates across many Ensembl sites and the addition of many genomes! 🐁🧍🏾🐖🐜🪲🌿
Read more in our new blog post ➡️ buff.ly/3PWsAD9
ALT Screenshot from the Ensembl genome browser with tracks displaying the HoxD cluster of genes alongside the conservation scores and constrained elements
Happy DNA day! Join us to celebrate the worldwide movement to empower communities to innovate, collaborate and discover genomics knowledge. Today marks the completion of Human Genome Project in 2003 and the discovery of the double helix of DNA in 1953 buff.ly/3JWzfGI
1/ In today’s #Tweetorial we are going to look at how to find specific #exons and #introns in your gene of interest. This may be helpful for selecting sequence to design #primers.
Today marks International Day of Women and Girls in Science. The world needs science, and science needs women and girls! Let's celebrate by recognising #WomenInScience who are leading us to a safer future #WellcomeGenomeWomen
Would you like to attend free virtual Ensembl Browser #workshop 9th-10th Nov?
Sign up here: buff.ly/3moN2KW
9am-1pm (Pacific Time):
Day 1
Viewing #genes, transcripts, variation data and the #VEP
Day 2
Data export with #BioMart, comparative #genomics and #gene regulation
We have 29 new genomes in our latest release:
🦁 3 mammals
🐟 7 fish
🐧 6 birds
🐢 4 reptiles
🌿 8 plants
🦟 1 mosquito
Find all details in the #Ensemblblog:
buff.ly/2W86sbn#Ensembl100 💯
#DNA from two mammoths that lived 1.2 million years ago revealed a new #mammoth lineage and has set a new record for the oldest DNA yet sequenced, pushing the study of ancient DNA closer to its theoretical limit.
@nature@love_dalenbuff.ly/3dpRack#aDNA#evolution
This year's #NobelPrize in Chemistry was awarded for the development of a method for #genome editing. Did you know that you can use #Ensembl to design #CRISPR gRNAs by turning on the CRISPR spCAS9 track, showing NGG CRISPR sites identified by the WGE resource?
#genomics
Its been 70 years since the discovery of the double helix and we cannot imagine life without it. We @emblebi are lucky to be located near @Cambridge_Uni ’s Cavendish lab and of course @TheEagleGK pub that first heard about the "discovery of the secret of life".
#DNADay23#DNADay
#Ensembl100 💯 is out, along with #EnsemblGenomes47! 🎉🎂
They bring you:
- GENCODE 34🚶& GENCODE M25 🐁
- gnomAD version 3 allele frequencies
- 29 new & 3 updated genomes
- New interface to configure multidimensional track hubs
More in the #Ensemblblog:
buff.ly/2W86sbn
A person has ~70 de novo mutations that are not in their parent’s #genome - and this number is affected by parental age - finds an @eLife study
buff.ly/2OVLlH8#genomics
"Ensemble" means to bring together. That's what we do here at Ensembl, we bring together datasets, such as genes, genetic variation and gene regulation into a single source, integrating them to learn more, and we can only do that because those datasets are #openaccess. #OAWeek
ALT A screenshot of the 'Region in Detail' view on the 'Location' tab in Sus scrofa (pig) highlighting the 'Regulatory Build' track now available in Ensembl.